ARTÍCULO ORIGINAL/ORIGINAL ARTICLE
Novel type 4 secretion system (T4SS)-related genes of Edwardsiella tarda
Nuevos genes relacionados con el sistema secretor tipo 4 de Edwardsiella tarda
Novo genes associados com o sistema secreção tipo 4 (T4SS) de Edwardsiella tarda
Noel Verjan - García1 2 3
Carlos A.2
Iregui Ikuo Hirono3
1MVZ, PhD, Immunobiology and Pathogenesis Research Group, Department of Animal Health, Faculty of Veterinary Medicine, Universidad del Tolima, Ibagué Colombia.
2MV, PhD, Pathobiology Laboratory, Faculty of Veterinary Medicine, Universidad Nacional de Colombia, Bogotá Colombia.
3PhD. Laboratory of Genome Science, Graduate School of Marine Science and Technology, Tokyo University of Marine Science and Technology, Konan 4-5-7, Minato, Tokyo 108-8477, Japan Email: nverjang@ut.edu.co
Recibido: noviembre 02 de 2013. Aceptado: agosto 16 de 2015
Summary
Edwardsiella tarda is a Gram-negative bacterium that causes edwardsiellosis, a disease of fish and mammals including humans and characterized by multiple abscesses. Different strains of E. tarda possess a number of virulence, antibioticresistance, and toxin secretion system-related genes that explain in some extent its capacity to survive within phagocytic cells and to infect a variety of hosts. Previously we introduced a virulent E. tarda strain (ETSJ54) isolated from Japanese flounder (Paralichthys olivaceus) with edwardsiellosis and reported a number of virulence-related genes. In this study we have re-analyzed the sequencing data of ETSJ54 and identified novel type IV secretion system-related genes, most of them were flanked by transposase and plasmid encoding genes. Interestingly, their nucleotide sequence had no identity to those of the genes published in the E. tarda EIB202 genome, a virulent strain isolated from turbot (Scophthalmus maximus) in China. The results suggest differences in gene content between geographically distinct E. tarda strains that may encourage additional E. tarda genome sequencing projects.
Keywords: Pathogenesis, T4SS genes, Virulence.
Resumen
Edwardsiella tarda es una bacteria Gram-negativa responsable de edwardsiellosis, una enfermedad de peces y mamíferos incluido el humano, la cual se caracteriza por la formación de múltiples abscesos. Distintas cepas de E. tarda poseen un número de genes asociados con virulencia, resistencia a múltiples antibióticos y sistemas secretores de toxinas que explican en cierto grado su capacidad de sobrevivir dentro de células fagocíticas y de infectar a diversos hospederos. En estudios previos, nuestro grupo secuencio parcialmente el genoma de una cepa virulenta de E. tarda (ETSJ54) aislada de lenguado japonés (Paralichthys olivaceus) con edwardsiellosis y reportó un número de genes asociados a su virulencia. En este estudio se ha re-analizado los datos de secuenciación y en este proceso se identificaron varios genes que codifican para la estructura de superficie Pili y el sistema secretor tipo IV, la mayoría de los cuales estuvieron rodeados por genes codificadores de transposasas y otros genes de origen plasmídico. La secuencia de nucleótidos de dichos genes no tuvieron identidad con la de los genes previamente reportados en E. tarda EIB202, una cepa virulenta aislada de turbot (Scophthalmus maximus) en China. Los resultados sugieren diferencias en el contenido genético de cepas de E. tarda de distinto origen geográfico y la necesidad de desarrollar nuevos proyectos de secuenciamiento de genomas de E. tarda.
Palabras clave: Patogenesis, Sistema secretor tipo IV, Virulencia.
Resumo
Edwardsiella tarda é uma bactéria Gram-negativas responsáveis pela edwardsiellosis, uma doença de peixes e mamíferos, incluindo os seres humanos, que é caracterizada pela formação de múltiplos abscessos. Diferentes cepas de E. Tarda possui um número de genes associados com a virulência e resistência a múltiplos antibióticos, sistemas secretores de toxinas, para explicar em certa medida a sua capacidade de sobreviver no interior das células fagocíticas e infectar diferentes hospedeiros. Em estudos anteriores o nosso grupo sequenciou parcialmente o genoma de uma estirpe virulenta de E. tarda (ETSJ54) isolado do linguado japonês Paralichthysolivaceus) com edwardsiellosis e relatou uma série de genes associados à virulência. Neste estudo foram analisados de novo os dados de seqüenciamento e, neste processo foram identificados vários genes que codificam para a estrutura de superfície Pili e sistema de secreção do tipo IV , a maioria dos quais oram cercados por transposase e outros genes de origem plasmídico. A sequência de nucleótidos dos genes nao tinham identidade com os genes previamente relatados em E. Tarda EIB202, uma cepa virulenta isolado do turbot (Scophthalmus maximus) na China. Os resultados sugerem diferenças no conteúdo genético de cepas de E. tardade origem geográfica diferente e a necessidade de desenvolver novos projetos de seqüenciamento do genoma E. tarda.
Palavras-chave: Patogênese, tipo de sistema de secretorIV, virulência.
Introduction
Edwardsiella tarda is a member of the enterobacteriaceae family that causes edwardsiellosis, a systemic suppurative disease of marine and fresh-water fishes around the world (Miyazaki and Kaige, 1985), such as Japanese flounder (Paralichthys olivaceus) and turbot (Scophthalmus maximus) cultured in Japan and China respectively, and red tilapia (Oreochromis spp.) cultured in Colombia (Iregui et al., 2012). The bacterium may cause sporadic infections in humans that varies from self-limited gastrointestinal and extra-intestinal infections with systemic abscesses up to lethal septicemia (Wang et al., 2005; Spencer et al., 2008;Verjan et al., 2012).
The virulence of E. tarda strains is associated with multiple factors including siderophores and hemolysins (Hirono et al., 1997), motility conferred by the flagellum (Mathew et al., 2001), and a type three secretion system (TTSS) that confers survival and replication advantages within macrophages (Rao et al., 2004; Zheng et al., 2005; Okuda et al., 2006). E. tarda as a typical facultative intracellular pathogen resists reactive oxygen species (ROS) and survives within phagocytic cells (Ishibe et al., 2008), a feature that is partially due to the production of enzymes including an iron-cofactored superoxide dismutase (FeSOD) (Cheng et al., 2010), and heat shock proteins (Dang et al., 2011). E. tarda also possesses a type four secretion system (T4SS) involved in horizontal DNA transfer to other bacteria and eukaryotic cells, toxin secretion and injection of virulence factors into host cells (Backert and Meyer, 2006). The genome of E. tarda EIB202, a virulent strain isolated from diseased turbot in China was recently reported, however, this particular strain appeared to be no motile and also possess an incomplete T4SS (Wang et al., 2009).
In previous studies, our group identified a number of antigenic and virulence-related genes in a motile E. tarda (ET54) strain isolated from diseased Japanese flounder (Verjan et al., 2005; Verjan, 2005b; Verjan et al., 2013). In this study, we have re-analyzed the sequencing data of E. tarda ETSJ54 to identify and annotate gene sequences coding for major structural components of the Pili and T4SS. The results indicate that some of those genes were absent in the previously sequenced genome of E. tarda EIB202 (Wang et al., 2009). The novel type IV conjugative transfer system-related genes were deposited in the GenBank database, and their putative roles are discussed. The results suggest important differences in gene content between geographically distinct E. tarda strains that may support the need for new genome sequencing projects.
Material and methods
Bacterial strains and Genomic DNA libraries of ETSJ54
E. tarda (ETSJ54) and Escherichia coli strains XL1-Blue MR and JM109 used as host for recombinant cosmid and generation of cosmid DNA libraries were described previously (Verjan et al., 2005; Verjan et al., 2013). Cosmid and plasmid preparation were performed following standard procedures (Sambrook and Russell, 2001). Table 1 shows a list of cosmid and plasmid clones encoding the identified ETSJ54 T4SS genes.
The nucleotide sequences were determined by the cycle sequencing method using Thermo sequenase fluorescent-labeled primer cycle sequencing kit (Amersham Pharmacia Biotech, Little Chalfont Buckinghamshire, UK). Briefly, cosmid and plasmid clones were cultured in LB agar plates with ampicillin and single colonies were randomly isolated and grown in 2YT broth for cosmid or plasmid DNA isolation. Sequencing of the terminal ends of cosmid DNA was performed with T3, 5´-(ATTAACCCTCACTAAAGGGA)-3´ and T7,5´TAATACGACTCACTATAGGG-3´primers sets to identify putative ORFs flanking the E. tarda DNA fragments. Detailed methods for genomic DNA library construction, subcloning and nucleotide sequence determination were reported recently (Verjan et al., 2013). The DNA sequence data of ETSJ54 were compared with those in the GenBank (www.ncbi.nlm.nih.gov) database using the BLASTX (Version 2.2.28+) software (Zhang et al., 2000) of the National Center for Biotechnology Information. The closest homologous gene sequences in other bacterial species allowed predicting its putative function or the potential origin of the DNA sequence. Multialignment of protein sequences was carried out with BioEdit and Genetyx version 7 programs and phylogenetic analysis was performed with the Molecular Evolutionary Genetics Analysis (MEGA) version 5.2 (Tamura et al., 2011), using the Neighbor Joining method. The novel T4SS-related genes of E. tarda ETSJ54 were submitted to the Gen-Bank database.
Results
A total of 9 protein-coding genes associated with the Pili and T4SS of E. tarda ETSJ54 were annotated, deposited in the GenBank database and the corresponding accession numbers are showed in Table 2. Comparison of their nucleotide sequence using the BLASTX software of NCBI, indicated that only two genes, those coding for the prepilin peptidase dependent protein D (ppdD) and the type IV pilus biogenesis protein (PilM) had identity to previously reported genes in E. tarda EIB202 genome (Wang et al., 2009) and E. tarda C07087 (Tekedar et al., 2013). Interestingly, the remaining gene sequences coding for the T4SS in E. tarda ETSJ54 did not have any nucleotide or deduced amino acid sequence identity to genes or protein sequences in the published E. tarda genomes (Table 2).
Using the BLASTX software at the NCBI website, the T4SS-related genes of E. tarda ETSJ54 showed nucleotide and deduced amino acid sequence identity to genes of well-known mammalian enteropathogens such as E. coli and Salmonella enterica, to fish pathogens such as Photobacterium damselae (Formally Pasteurella piscicida) and Vibrio mimicus, and to entomopathogens such as Xenorhabdus nematophila, indicating that although the T4SS is highly conserved within enterobacteriaceae members, there could be E. tarda strains such as the E. tarda EIB202 lacking those genetic elements or that they may be missing in the sequenced genomes. Another possibility could be that uncharacterized proteins grouped as hypothetical proteins in those E. tarda strains might be associated with the missing T4SS proteins.
The E. tarda ETSJ54 type IV conjugative transfer system genes showed 73-100 % nucleotide and deduced amino acid sequence identity to the genes and proteins of other enterobacteriaceae members with a nucleotide sequence coverage ranging from 61 to100% (Table 2). A partial nucleotide and deduced amino acid sequence of the E. tarda ETSJ54 type IV conjugative transfer system protein TraI is presented in Figure 1. The provided TraI DNA sequence is 2004 bp in length and encodes a protein of 667 amino acids, possesses one HincII restriction site at position 280, one SacI restriction site at position 757 and one Pst I restriction site at position 805 (sequence underlined). The stop codon (TGA) is indicated at position 2002, whereas the start codon and a range of amino acids at the N-terminal region are missing in this sequence (Figure 1).
A multi-alignment of E. tarda ETSJ54 TraI deduced amino acid sequence was constructed with the closest homologous protein sequences and a summary of this alignment is presented in Figure 2. Despite the missing N-terminal region of TraI protein, the deduced amino acid sequence of ETSJ54 TraI showed 75% identity to Photobacterium damsealae subsp. Piscicida (502/670), Vibrio mimicus VM603 (503/674) and Yersinia ruckeri (503/670) TraI protein sequences. In addition, ETSJ54 TraI showed 74% identity to E.coli TraI (496/668) and 72% identity to Aeromonas hydrophila (480/667) and Salmonella enterica (477/667) TraI proteins, whereas it has 90% identity to a Xenorhabdus nematophila (341/377) TraI protein fragment of 377 amino acids. Of note, ETSJ54 TraI protein showed several amino acid deletions and additions when compared to Photobacterium damselae subsp. Piscicida TraI deduced amino acid sequence (Figure 2).
The novel E. tarda genes were compared to those in the GenBank database and similar phylogenetic distances between the E. tarda ETSJ54 TraI protein sequence and those proteins from other enterobacteriaceae were found. Figure 3 shows that E. tarda ETSJ54 TraI protein cluster more closely with Xenorhabdus nematophila and E. coli TraI proteins and that it may have evolved from fish pathogens such as Aeromonas hydrophila or Aeromonas salmonicida TraI proteins.
Discussion
The bacterial Pili is classified as a fimbrial type adhesin that is involved in adhesion, invasion and colonization of host tissues. These processes are then improved by other non fimbrial adhesins such as the flagellum (Amano, 2010; Friedlander et al., 2013), and outer membrane proteins (Confer and Ayalew, 2013). Enzymes such as sialidase NanA, may also contribute to the adhesion, colonization and dissemination events of E. tarda in fish tissues (Jin et al., 2012). The virulence and pathogenicity of E. tarda may also involve various surface structures including a Pili-associated type IV conjugative transfer system, a subset of the type IV secretion system (T4SS), that is usually located in mobile genetic elements such as pathogenicity islands or plasmids encoding antibiotic resistance genes and transposases (Yu et al., 2012). The bacterial T4SS and particularly their effector proteins have been involved in many pathogenic mechanisms of bacteria including the interference of the actin cytoskeleton rearrangements by Helicobacer pylori, the exotoxin (pertussis toxin, Ptx) secretion by Bordetella pertussis, the prevention of phagosome-lysosome fusion that allows intracellular replication of Legionella pneumophila and Brucella species, and the modulation of vacuole biogenesis by Coxiella species (Backert and Meyer, 2006; Bruggemann et al., 2006), and based on those properties, bacterial T4SS are beginning to be considered as an important DNA delivery tool for human cells that may allow the development of cell and tissue-specific gene therapies (Llosa et al., 2012). At present, the exact function of E. tarda T4SS in the virulence and pathogenesis in fish and mammals remains unknown.
The T4SS are classified into four groups based on phylogenetic relationships and despite the lack of complete nomenclature and standardization, they include (1) F-T4SS (Tra/Trb), (2) P-T4SS (VirB/D4), (3) I-T4SS (Dot/Icm) that resembles the incompatibility (Inc) IncF, IncP and IncI plasmid conjugation systems, and (4) the GI-T4SS, associated with genomic islands (Juhas et al., 2008). An alternative classification of T4SS was proposed based on they function which includes conjugation machines, effector translocators and DNA release/ uptake systems (Alvarez-Martinez and Christie, 2009). Recently, a database called Atlas T4SS, holding a collection of 1,617 predicted proteins encoding the T4SS was developed to help the assignment of given coding sequence (Souza et al., 2012). The identified genes in E. tarda ETSJ54 indicate that this bacterium possess a T4SS that maybe involved in protein-ss DNA complex transfer but functions in adhesion and invasion of fish tissues cannot be excluded. The E. tarda ETSJ54 T4SS may belong to the type I group or F-T4SS described in E. coli (Lawley et al., 2003), and by using the Atlas T4SS database, we found that four out of seven (TraD, TraB, TraF and TraH) E. tarda T4SS protein sequences had identity to previously reported Haemophilus influenzae conjugal transfer protein TraD (Plasmid ICEhin1056), Salmonella typhi plasmid transfer protein TraB, Salmonella typhi conjugal transfer protein TraF-F, and Legionella pneumophila subsp. pneumophila Ftype conjugal transfer protein TraH, respectively, whereas the E. tarda TraI, TraK and TraE did not have any significant hit when compared to the proteins in this database. Of note, these proteins and microorganisms were different to the significant hits obtained by using the BLAST tool at the NCBI website (Table 2). These results also support the possibility of highly diverse T4SS protein sequences between enterobacteriaceae families and that the current available tools still have limitations to properly classify T4SS proteins.
The process of bacterial conjugation involves the formation of a mating bridge and a close contact between donor and recipient cells that allows the transfer of genetic material between bacteria. One of the most studied mechanisms is the plasmid-encoded extracellular filament or F pilus (Tra/Trb) in E. coli (Frost et al., 1994) that allows intergeneric and interkingdom F plasmid transfer. Among the E. tarda ETSJ54 T4SS-related genes, we identified genes involved in binding and pumping of DNA into the recipient cell, traD that may also have a role in pilus assembly; DNA transfer (tra) genes such as traB, traE, traF, traK and traH involved in F pilus assembly; and traI that encodes a relaxase/helicase I, involved in two functions, oriT nicking and unwinding in the 5´-to-3´direction (Table 2), and finally a sequence encoding TraN-like protein associated with matingpair stabilization (Not shown). The E. tarda ETSJ54 tra genes were found in close proximity to genes coding for multidrug efflux proteins of Salmonella enterica, sulfonamide resistance protein (Sul1) of Pseudomonas putida HB3267, and Streptomycin resistance protein (AadA) of Aeromonas salmonicida subsp. salmonicida A449, and particularly those genes were flanked by transposase genes IS21, IS100 and IstB of Escherichia coli, suggesting that E. tarda ETSJ54 T4SS-related genes might have been acquired horizontally and encoded in an uncharacterized plasmid, nevertheless, the presence of mobile genetic elements, currently known as "integrative and conjugative elements" (ICEs) suggests they could also be integrated in the genome of E. tarda ETSJ54. Integrated conjugative plasmids and ICE are known to mediate the unidirectional transfer of single strand large fragments of chromosomal DNA and shape the architecture of bacterial genomes (Alvarez-Martinez and Christie, 2009). Pathogens with extensive genetic diversity such as Helicobacter pylori, have also chromosomally encoded TraG-like proteins and relaxase (rlx) proteins (Backert et al., 2005).
To obtain a better understanding of the evolutionary relationships of E. tarda T4SS genes, we performed a preliminary phylogenetic analysis and found that although the deduced amino acid sequence of E. tarda relaxase TraI has been acquired from common fish pathogens such as Aeromonas sp., and Photobacterium damselae, it appeared to be more closely related to a TraI fragment of the plant pathogen X. nematophila and to E. coli TraI protein, suggesting a most probably intergenus transfer from E. coli. The relationship of ETSJ54 TraI with the plant pathogen X. nematophila is currently unknown. Additional studies are required to define the precise origin and function of E. tarda T4SS-related genes and detection/identification of other potential tra genes such as the regulatory genes of the F transfer operon (traJ), pilus synthesis and assembly (traA, traQ, traX), mating-aggregate stabilization (traG) and surface exclusion (traT and traS) genes (Frost et al., 1994) that are currently missing or have not been identified.
Conclusions
E. tarda virulence is complex and involves multiple factors including diverse toxin secretion systems such as the T4SS that may allow genetic material transfer between bacteria and bacteria-host cells, but also adhesion and colonization properties. A partial genome analysis of a virulent strain of E. tarda (ETSJ54) allowed the identification of a series of virulence-related genes coding for T4SS components that were absent in previously reported complete genome of a virulent and multi-drug resistant E. tarda EIB202 isolated in China. The T4SS-related genes in ETSJ54 were associated with various transposases genes and other mobile genetic elements, indicating that the process of DNA exchange and acquisition between E. tarda and other bacteria might be an active process of genetic material transfer and evolution. Further studies are needed to clarify the exact origin and role of this surface structure during infection of fish and mammal hosts.
Acknowledgements
This study was supported in part by Grants-in-Aid for Scientific Research from the Ministry of Education, Science, Sports and Culture of Japan.
References
Miyazaki T, Kaige N. Comparative histopathology of edwardsiellosis in fishes. Fish Pathol. 1985;20:219-227.
Iregui CA, Guarin M, Tibata VM, Ferguson HW. Novel brain lesions caused by Edwardsiella tarda in a red tilapia (Oreochromis spp.). J Vet Diagn Invest. 2012;24:446-449.
Verjan N, Iregui CA, Hirono I. Edwardsiellosis, common and novel manifestations of the disease: A review. Revista Colombiana de Ciencia Animal, RCCA. 2012;5:73-82.
Wang IK, Kuo HL, Chen YM, Lin CL, Chang HY, Chuang FR, et al. Extraintestinal manifestations of Edwardsiella tarda infection. Int J Clin Pract. 2005;59:917-921.
Spencer JD, Hastings MC, Rye AK, English BK, Ault BH. Gastroenteritis caused by Edwardsiella tarda in a pediatric renal transplant recipient. Pediatr Transplant. 2008;12:238-241
Wang Q, Yang M, Xiao J, Wu H, Wang X, Lv Y, et al. Genome sequence of the versatile fish pathogen Edwardsiella tarda provides insights into its adaptation to broad host ranges and intracellular niches. PLoS One. 2009;4:e7646.
Hirono I, Tange N, Aoki T. Iron-regulated haemolysin gene from Edwardsiella tarda. Mol Microbiol. 1997;24:851-856.
Mathew JA, Tan YP, Srinivasa Rao PS, Lim TM, Leung KY. Edwardsiella tarda mutants defective in siderophore production, motility, serum resistance and catalase activity. Microbiology. 2001;147:449-457.
Rao PS, Yamada Y, Tan YP, Leung KY. Use of proteomics to identify novel virulence determinants that are required for Edwardsiella tarda pathogenesis. Mol Microbiol. 2004;53:573-586.
Zheng J, Tung SL, Leung KY. Regulation of a type III and a putative secretion system in Edwardsiella tarda by EsrC is under the control of a two-component system, EsrA-EsrB. Infect Immun. 2005;73:4127-4137.
Okuda J, Arikawa Y, Takeuchi Y, Mahmoud MM, Suzaki E, Kataoka K, et al. Intracellular replication of Edwardsiella tarda in murine macrophage is dependent on the type III secretion system and induces an up-regulation of anti-apoptotic NF-kappaB target genes protecting the macrophage from staurosporine-induced apoptosis. Microb Pathog. 2006;41:226-240.
Ishibe K, Osatomi K, Hara K, Kanai K, Yamaguchi K, Oda T. Comparison of the responses of peritoneal macrophages from Japanese flounder (Paralichthys olivaceus) against high virulent and low virulent strains of Edwardsiella tarda. Fish Shellfish Immunol. 2008;24:243-251.
Cheng S, Zhang M, Sun L. The iron-cofactored superoxide dismutase of Edwardsiella tarda inhibits macrophage-mediated innate immune response. Fish Shellfish Immunol. 2010;29:972-978.
Dang W, Hu YH, Sun L. HtpG is involved in the pathogenesis of Edwardsiella tarda. Vet Microbiol. 2011;152:394-400.
Backert S, Meyer TF. Type IV secretion systems and their effectors in bacterial pathogenesis. Curr Opin Microbiol. 2006;9:207-217.
Verjan N, Hirono I, Aoki T. Genetic loci of major antigenic protein genes of Edwardsiella tarda. Appl Environ Microbiol. 2005;71:5654-5658.
Verjan N. Virulence-related and antigenic protein coding genes of Edwardsiella tarda. PhD thesis, Tokyo University of Marine Science and Technology, Tokyo, Japan. 2005b.
Verjan N, Iregui C, Hirono I. A random genome analysis of Edwardsiella tarda ETSJ54: annotation of putative virulence-related genes. Orinoquia. 2013;17(1):69-83.
Hou JH, Zhang WW, Sun L. Immunoprotective analysis of two Edwardsiella tarda antigens. J Gen Appl Microbiol. 2009;55:57-61.
Sambrook J, Russell DW. 2001. Molecular cloning. A Laboratory Manual. Third edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
Ausubel FH, Brent R, Kingston E, Moore DD, Seidman JG, Smith JA, et al. 1994. Current protocols in Molecular Biology. John Wiley and Son.
Zhang Z, Schwartz S, Wagner L,Miller W. A greedy algorithm for aligning DNA sequences. J Comput Biol. 2000;7:203-214.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, and Kumar S. Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol Biol Evol. 2011;28:2731-2739.
Tekedar HC, Karsi A, Williams ML, Vamenta S, Banes MM, Duke M, et al. 2013. Genome sequence of the fish pathogen Edwarsiella tarda C07-087. Published only in database.
Amano A. Bacterial adhesins to host components in periodontitis. Periodontol 2000 2010;52:12-37.
Friedlander RS, Vlamakis H, Kim P, Khan M, Kolter R, Aizenberg J. Bacterial flagella explore microscale hummocks and hollows to increase adhesion. Proc Natl Acad Sci U S A. 2013;110:56245629.
Confer AW, Ayalew S. The OmpA family of proteins: roles in bacterial pathogenesis and immunity. Vet Microbiol. 2013;163:207-222.
Jin RP, Hu YH, Sun BG, Zhang XH, Sun L. Edwardsiella tarda sialidase: pathogenicity involvement and vaccine potential. Fish Shellfish Immunol. 2012;33:514-521.
Yu JE, Cho MY, Kim JW, Kang HY. Large antibiotic-resistance plasmid of Edwardsiella tarda contributes to virulence in fish. Microb Pathog. 2012;52:259-266.
Bruggemann H, Cazalet C, Buchrieser C. Adaptation of Legionella pneumophila to the host environment: role of protein secretion, effectors and eukaryotic-like proteins. Curr Opin Microbiol. 2006;9:86-94.
Llosa M, Schroder G, Dehio C. New perspectives into bacterial DNA transfer to human cells. Trends Microbiol. 2012;20:355-359.
Juhas M, Crook DW, Hood DW. Type IV secretion systems: tools of bacterial horizontal gene transfer and virulence. Cell Microbiol. 2008;10:2377-2386.
Alvarez-Martinez CE, Christie PJ. Biological diversity of prokaryotic type IV secretion systems. Microbiol Mol Biol Rev. 2009;73:775-808.
Souza RC, del Rosario Quispe Saji G, Costa MO, Netto DS, Lima NC, Klein CC, et al. AtlasT4SS: a curated database for type IV secretion systems. BMC Microbiol. 2012;12:172.
Lawley TD, Klimke WA, Gubbins MJ, Frost LS. F factor conjugation is a true type IV secretion system. FEMS Microbiol Lett. 2003;224:1-15.
Frost LS, Ippen-Ihler K, Skurray RA. Analysis of the sequence and gene products of the transfer region of the F sex factor. Microbiol Rev. 1994;58:162-210.
Backert S, Kwok T, Konig W. Conjugative plasmid DNA transfer in Helicobacter pylori mediated by chromosomally encoded relaxase and TraG-like proteins. Microbiology. 2005;151:34933503.